(2000) suggested 17,000 years ago. Y chromosomal heritage of Croatian population and its island isolates. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. Distribution. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. Eur J Hum Genet 2003; 11: 535542. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. Russ J Genet 2004; 40: 326331. Distribution. [43] L240 was identified in 2009. (a) Principal component analysis by population. Amongst the Madjars, G1 was found at a rate of 87%. Ann Hum Genet 2004; 68: 588599. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. Categories have alternating letters and numbers. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. Sengupta S, Zhivotovsky LA, King R et al. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Y chromosome sequence variation and the history of human populations. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Because M201 was identified first, it is the standard SNP test used when testing for G persons. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). Haplogroup G represents one of the first peoples in Europe. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. and JavaScript. Cinnioglu C, King R, Kivisild T et al. Am J Hum Genet 2000; 67: 15261543. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. To obtain In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. Semino et al. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. Thus, these estimates should be viewed as the upper bounds of dispersal times. The G-M286 subclade (M286+) is small compared with G-L91. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. Its chromosome location listed as 21653414. Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. CAS Eur J Hum Genet 2007; 15: 485493. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Am J Hum Genet 2007; 80: 759768. Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. (2004) suggested the mutation took place only 9,500 years ago. Am J Hum Genet 2004; 74: 694704. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. So far all G2a1 persons have a value of 10 at STR marker DYS392. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). There were only a few G categories until 2008 when major revisions to categories were made. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Am J Hum Genet 2008; 82: 873882. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Mol Phylogenet Evol 2007; 44: 228239. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) G1-M285, previously described in the Iranian population . The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. Evaluation of Y-chromosomal STRs: a multicenter study. The haplogroup G mutation developed about 21,000 to 14,000 years ago. Princeton: Princeton University Press, 1994. (2000) suggested 17,000 years ago. ISSN 1018-4813 (print), Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus, Subdividing Y-chromosome haplogroup R1a1 reveals Norse Viking dispersal lineages in Britain, Phylogenetic analysis of the Y-chromosome haplogroup C2b-F1067, a dominant paternal lineage in Eastern Eurasia, Y-chromosomal connection between Hungarians and geographically distant populations of the Ural Mountain region and West Siberia, Origin and diffusion of human Y chromosome haplogroup J1-M267, Bidirectional dispersals during the peopling of the North American Arctic, The role of matrilineality in shaping patterns of Y chromosome and mtDNA sequence variation in southwestern Angola, Ancient human mitochondrial genomes from Bronze Age Bulgaria: new insights into the genetic history of Thracians, Medieval Super-Grandfather founder of Western Kazakh Clans from Haplogroup C2a1a2-M48, Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians, http://harpending.humanevo.utah.edu/popstr/, Population genetic study of 17 Y-STR Loci of the Sorani Kurds in the Province of Sulaymaniyah, Iraq, Phylogenetic history of patrilineages rare in northern and eastern Europe from large-scale re-sequencing of human Y-chromosomes, Sex-biased patterns shaped the genetic history of Roma, Middle eastern genetic legacy in the paternal and maternal gene pools of Chuetas, Cancel Members of this group have been found in Europe and the Middle East.[3]. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. Almost all L141 men belong to L141 subclades. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). The mutations involved may be complicated and difficult to interpret. PLoS Biol 2010; 8: e1000536. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. For the human mtDNA haplogroup, see. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Ann Hum Genet 2005; 69: 443454. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Science 2000; 290: 11551159. The origin of haplogroup G is controversial. Hum Genet 2004; 114: 127148. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). New insights into the Tyrolean Icemans origin and phenotype as inferred by whole-genome sequencing. This is likely due to a local founder effect.[40]. Haplogroup S, as of 2017, is also known as K2b1a. Hum Genet 2009; 126: 707717. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. [2], In 2012, a paper by Siiri Rootsi et al. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. P287 was identified at the University of Arizona and became widely known in late 2007. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. The discovery of new SNPs can result in assignment of new names to haplogroup categories. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Haplogroup G was the first branch of Haplogroup F outside of Africa. Barac L, Pericic M, Klaric IM et al. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. We attempted to localize the potential geographic origin of . The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Haplogroup H [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. The L141 mutation involves an insertion.[35]. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. They are found only in tiny numbers elsewhere. This is achieved by comparing the haplotypes through the STR markers. Hammer MF, Behar DM, Karafet TM et al. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. Peter A Underhill. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. The authors declare no conflict of interest. Am J Hum Genet 2002; 70: 265268. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. Kaniewski D, Van Campo E, Van Lerberghe K et al. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. P257 was first reported in 2008. Kharkov VN, Stepanov VA, Borinskaya SA et al. Its age is between 7,700 and . G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.
Annoying Create And Craft Presenters,
Where To Find Sonoran Desert Toad,
Articles H